Risultati della ricerca

• 1. Pirin-A-novel-redoxsensitive-modulator-of-primary-and-secondary-metabolism-in-Streptomyces2018Metabolic-Engineering (100%)

  8-ago-2019 15.24.41

  of Biological, Chemical and Pharmaceutical Sciences and Technologies (STEBICEF), University of Palermo ... , selected reaction monitoring mode; TAG, triacylglycerols; TES, Tris EDTA buffer saline; vLCAD, very ... epitope tag DNA (GGTAAGCCTATCCCTAACCCTCTCCTC phenomenon, we have analyzed the transcriptome and ... in triacylglycerols (TAG) accumulation between the dif- centrifugation and plated on YS agar for the count. ferent ... in the ratio between total lipid esters (neutral TAG and polar membrane lipids) and proteins

• 2. Pubblicazioni STEBICEF anno 2018 - quartile q1, q2, q3, q4 (class. WOS) (59%)

  3-ott-2019 10.22.37

  Pubblicazioni STEBICEF anno 2018 - quartile q1, q2, q3, q4 (class. WOS) pxq14,pubblicazioni,stebicef Authors Title Year Source title JIF quartile (WOS) DOI Link Document Type Source EID Agnello S., Palumbo F.S., Pitarresi G., Fiorica C., Giammona G. Synthesis and evaluation of thermo-rheological behaviour and ionotropic crosslinking of new gellan gum-alkyl derivatives 2018 Carbohydrate Polymers q1 10.1016/j.carbpol.2018.01.021 https://www.scopus.com/inward/record.uri?eid=2-s2.0-85044681722&