Skip to main content
Passa alla visualizzazione normale.

PATRIZIA BELLA

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

  • Authors: Bella, P.; Gargano, M.L.; Davino, S.; Davino, M.; Arizza, V.; Bawadekji, A.; Catara, V.; Compagno, R.; Venturella, G.
  • Publication year: 2015
  • Type: Poster pubblicato in rivista
  • Key words: Desert truffles, Antibacterial activity, Plant Pathogenetic Bacteria
  • OA Link: http://hdl.handle.net/10447/148789

Abstract

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in both directions. Nucleotide sequences of ITS obtained were compared with 103 sequences of different species of desert truffles (Tirmania and Terfezia) retrieved from GenBank. The substitution model that best fit these sequences with the lowest Bayesian information criterion (BIC) was calculated. Phylogenetic relationships were inferred by the maximum-likelihood method with 1,000 bootstrap replicates to estimate the statistical significance of each node, using the algorithm Tamura-3-parameter, assuming variable substitution rates among nucleotide sites with a discrete gamma distribution (+G) of 0.43. All these analyses were performed with the MEGA 6.06 program. Both methods identified the samples as T. pinoyi (Maire) Malençon and T. claveryi Chatin. The acid-soluble protein extracts of the two mushroom samples were obtained by sonication of 5 g of freeze-dried truffle in extraction solution (10% acetic acid in phosphate saline buffer). The extracts were adjusted to a protein concentration of 200 µg mL-1. The antimicrobial activity could have an interesting field of exploitation in agriculture where antibiotics are not allowed anymore in many Countries. The antimicrobial activity of the acid-soluble protein extracts was tested against Gram-positive and Gram-negative plant pathogenic bacteria. Using a double layer well-diffusion method in potato dextrose agar we observed that both extracts produced clear inhibition zones around the wells inhibiting the growth of bacterial strains of Pectobacterium carotovorum subsp. carotovorum, Pseudomonas corrugata, P. mediterranea, P. syringae pv. syringae, P. syringae pv. tomato, Xanthomonas vesicatoria, Clavibacter michiganensis subsp. nebraskensis and C. michiganensis subsp. michiganensis. The two acid-soluble protein extracts were further evaluated in liquid cultures kinetic bacterial growth assays against three bacteria species causal agents of diseases on tomato worldwide. Microbial growth was automatically determined using a Bioscreen C (Labsystems, Helsinki, Finland), which measures kinetically, the development of turbidity. Microplates were incubated at 25°C with 20 s of shaking every half-hour before absorbance measurements for 48 h. Dilutions of the truffle extracts were made in Luria Broth (LB) to obtain final concentrations of 200, 100, 50, 25, 12.5, 6.25 mg mL-1. One-hundred eighty microliters of each dilution was mixed in each well of a microtiter plate with 20 µl of bacterial suspension. Three replicates for each strain, truffle extract, and concentration were tested. Positive control wells for bacterial growth contained only LB. Both truffle extracts completely inhibit the bacterial growth of P. corrugata, P. syringae pv. tomato and X. vesicatoria at all dilution tested except for 6.25 mg mL-1.